Review



protoscript ii rt reaction buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    New England Biolabs protoscript ii rt reaction buffer
    Protoscript Ii Rt Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1438 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/protoscript+ii+rt+reaction+buffer/ProtoScript+II+Reverse+Transcriptase/pmc11369270-362-32-37
    Average 98 stars, based on 1438 article reviews
    protoscript ii rt reaction buffer - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: DMDA-PatA mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs.
    Article Snippet: .. The reaction mixture containing 25 nM mRNA reporter, 12.5 nM FAM-labeled reverse transcription primer, 0.5mM(each) dNTPs, 0.5mMddNTPs (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScript II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30 °C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: Domain swapping between homologous bacterial small RNAs dissects processing and Hfq binding determinants and uncovers an aptamer for conditional RNase E cleavage
    Article Snippet: .. The reaction was started by addition of 200 u ProtoScript II Reverse Transcriptase (NEB) in ProtoScript II RT Reaction buffer (NEB) containing 40 u RNase Inhibitor (Thermo Scientific) and 10 mM DTT. ..

    Article Title: DMDA-PatA mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs
    Article Snippet: .. The reaction mixture containing 25 nM mRNA reporter, 12.5 nM FAM-labeled reverse transcription primer, 0.5 mM (each) dNTPs, 0.5 mM ddNTPs (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScript II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30 °C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: Pateamine A mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs
    Article Snippet: .. The reaction containing 25 nM mRNA reporter, 12.5 nM RT primer, 0.5 mM (each) dNTPs, 0.5 mM ddNTP (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScrip II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30°C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: Kisspeptin Effect on Endothelial Monocyte Activating Polypeptide II (EMAP-II)-Associated Lymphocyte Cell Death and Metastases in Colorectal Cancer Patients
    Article Snippet: .. The RT Mix containing 200 U/μL M-MuLV ProtoScript II Reverse Transcriptase, 5× ProtoScript II RT Reaction buffer, 0.1 mol/L DTT and murine RNAse inhibitor (40 U/μL) (all available at New England Biolabs) was then added, and the reactants were incubated at 42oC for 50 min and 70oC for 20 min. Each reaction was obtained in 25 μL by using 12 μL SYBR green Super-mix (Bio-Rad, Hercules, CA, USA), 0.5 μg/mL oligo dTs (Fermantas/Thermo Fisher Scientific Inc.), 2 μL cDNA, and 0.3 μmol/L primers for insulin receptor (IR) and insulinlike growth factor 1 receptor (IGF-1R) (primers: EMAP-II, forward: TGAGG CAGTGACAGAGCGATTACTA; reverse: ACCTTGGCTGACTTGGCTCGC [ 25 ]; kisspeptin: forward, TGCCCACCCT CTGGACATTC; reverse, TACGCAACAT TTCTTTTATTGCCTC; β-actin: forward, CCTCGCCTTTGCCGA; reverse, TGGTG CCTGGGGCG [ 26 ]). ..

    Article Title: Immunomodulatory intervention with interferon-γ in Escherichia coli pyelonephritis.
    Article Snippet: Accepted for publication March 14, 2014.. Study received approval from the Veterinary Directorate of the Prefecture of Athens.. * Correspondence, 4th Department of Internal Medicine, Attikon University Hospital, 1 Rimini St., 124 62 Athens, Greece (telephone: þ30 210 58 32 562; FAX: þ30 210 53 26 446; e-mail: katsarismud8@yahoo.com).

    Incubation:

    Article Title: DMDA-PatA mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs.
    Article Snippet: .. The reaction mixture containing 25 nM mRNA reporter, 12.5 nM FAM-labeled reverse transcription primer, 0.5mM(each) dNTPs, 0.5mMddNTPs (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScript II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30 °C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: DMDA-PatA mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs
    Article Snippet: .. The reaction mixture containing 25 nM mRNA reporter, 12.5 nM FAM-labeled reverse transcription primer, 0.5 mM (each) dNTPs, 0.5 mM ddNTPs (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScript II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30 °C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: Pateamine A mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs
    Article Snippet: .. The reaction containing 25 nM mRNA reporter, 12.5 nM RT primer, 0.5 mM (each) dNTPs, 0.5 mM ddNTP (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScrip II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30°C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: Kisspeptin Effect on Endothelial Monocyte Activating Polypeptide II (EMAP-II)-Associated Lymphocyte Cell Death and Metastases in Colorectal Cancer Patients
    Article Snippet: .. The RT Mix containing 200 U/μL M-MuLV ProtoScript II Reverse Transcriptase, 5× ProtoScript II RT Reaction buffer, 0.1 mol/L DTT and murine RNAse inhibitor (40 U/μL) (all available at New England Biolabs) was then added, and the reactants were incubated at 42oC for 50 min and 70oC for 20 min. Each reaction was obtained in 25 μL by using 12 μL SYBR green Super-mix (Bio-Rad, Hercules, CA, USA), 0.5 μg/mL oligo dTs (Fermantas/Thermo Fisher Scientific Inc.), 2 μL cDNA, and 0.3 μmol/L primers for insulin receptor (IR) and insulinlike growth factor 1 receptor (IGF-1R) (primers: EMAP-II, forward: TGAGG CAGTGACAGAGCGATTACTA; reverse: ACCTTGGCTGACTTGGCTCGC [ 25 ]; kisspeptin: forward, TGCCCACCCT CTGGACATTC; reverse, TACGCAACAT TTCTTTTATTGCCTC; β-actin: forward, CCTCGCCTTTGCCGA; reverse, TGGTG CCTGGGGCG [ 26 ]). ..

    Article Title: Immunomodulatory intervention with interferon-γ in Escherichia coli pyelonephritis.
    Article Snippet: Accepted for publication March 14, 2014.. Study received approval from the Veterinary Directorate of the Prefecture of Athens.. * Correspondence, 4th Department of Internal Medicine, Attikon University Hospital, 1 Rimini St., 124 62 Athens, Greece (telephone: þ30 210 58 32 562; FAX: þ30 210 53 26 446; e-mail: katsarismud8@yahoo.com).

    Purification:

    Article Title: DMDA-PatA mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs.
    Article Snippet: .. The reaction mixture containing 25 nM mRNA reporter, 12.5 nM FAM-labeled reverse transcription primer, 0.5mM(each) dNTPs, 0.5mMddNTPs (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScript II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30 °C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: DMDA-PatA mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs
    Article Snippet: .. The reaction mixture containing 25 nM mRNA reporter, 12.5 nM FAM-labeled reverse transcription primer, 0.5 mM (each) dNTPs, 0.5 mM ddNTPs (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScript II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30 °C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    Article Title: Pateamine A mediates RNA sequence-selective translation repression by anchoring eIF4A and DDX3 to GNG motifs
    Article Snippet: .. The reaction containing 25 nM mRNA reporter, 12.5 nM RT primer, 0.5 mM (each) dNTPs, 0.5 mM ddNTP (ddATP, ddTTP, ddGTP, or ddCTP), ProtoScrip II Reverse Transcriptase, and 1× ProtoScript II RT Reaction Buffer (New England Biolabs) was incubated for 1 h at 30°C. cDNAs were purified with an Oligo Clean & Concentrator Kit and analyzed as described above. ..

    SYBR Green Assay:

    Article Title: Kisspeptin Effect on Endothelial Monocyte Activating Polypeptide II (EMAP-II)-Associated Lymphocyte Cell Death and Metastases in Colorectal Cancer Patients
    Article Snippet: .. The RT Mix containing 200 U/μL M-MuLV ProtoScript II Reverse Transcriptase, 5× ProtoScript II RT Reaction buffer, 0.1 mol/L DTT and murine RNAse inhibitor (40 U/μL) (all available at New England Biolabs) was then added, and the reactants were incubated at 42oC for 50 min and 70oC for 20 min. Each reaction was obtained in 25 μL by using 12 μL SYBR green Super-mix (Bio-Rad, Hercules, CA, USA), 0.5 μg/mL oligo dTs (Fermantas/Thermo Fisher Scientific Inc.), 2 μL cDNA, and 0.3 μmol/L primers for insulin receptor (IR) and insulinlike growth factor 1 receptor (IGF-1R) (primers: EMAP-II, forward: TGAGG CAGTGACAGAGCGATTACTA; reverse: ACCTTGGCTGACTTGGCTCGC [ 25 ]; kisspeptin: forward, TGCCCACCCT CTGGACATTC; reverse, TACGCAACAT TTCTTTTATTGCCTC; β-actin: forward, CCTCGCCTTTGCCGA; reverse, TGGTG CCTGGGGCG [ 26 ]). ..



    Similar Products

    protoscript ii rt reaction buffer  (New England Biolabs)
    98
    New England Biolabs protoscript ii rt reaction buffer
    Protoscript Ii Rt Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/protoscript+ii+rt+reaction+buffer/ProtoScript+II+Reverse+Transcriptase/pmc11369270-362-32-37
    Average 98 stars, based on 1 article reviews
    protoscript ii rt reaction buffer - by Bioz Stars, 2026-09
    98/100 stars
    		  Buy from Supplier

    Image Search Results